http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1001140
"dMyc Functions Downstream of Yorkie to Promote the Supercompetitive Behavior of Hippo Pathway Mutant Cells".
Marcello Ziosi 1, #, Luis Alberto Baena-López 2, #, Daniela Grifoni 1, 3, *, Francesca Froldi 1, Andrea Pession 4, Flavio Garoia 5, Vincenzo Trotta 3, Paola Bellosta 6, Sandro Cavicchi 3, and Annalisa Pession 1
1 Dipartimento di Patologia Sperimentale, Alma Mater Studiorum,
Bologna, Italy,
2 National Institute for Medical Research, London, United
Kingdom,
3 Dipartimento di Biologia Evoluzionistica Sperimentale,
Alma Mater Studiorum, Bologna, Italy,
4 Dipartimento di Ginecologia, Ostetricia e Pediatria,
Alma Mater Studiorum, Bologna, Italy,
5 NGB Genetics s.r.l, University of Ferrara, Ferrara,
Italy,
6 Department of Biology, City College of the City University
of New York, New York, New York, USA
* E-mail: daniela.grifoni@unibo.it
# These authors contributed equally to this work.
Received: December 11, 2009; Accepted: August 24, 2010; Published: September 23, 2010
Genetic analyses in Drosophila epithelia have suggested that
the phenomenon of cell competition could participate in organ
homeostasis. It has been speculated that competition between different
cell populations within a growing organ might play a role as either tumor
promoter or tumor suppressor, depending on the cellular context. The evolutionarily
conserved Hippo (Hpo) signaling pathway regulates organ size
and prevents hyperplastic disease from flies to humans by restricting
the activity of the transcriptional cofactor Yorkie (yki).
Recent data indicate also that mutations in several Hpo pathway members
provide cells with a competitive advantage by unknown mechanisms. Here
we provide insight into the mechanism by which the Hpo pathway is linked
to cell competition, by identifying dMyc as a target gene
of the Hpo pathway, transcriptionally upregulated by the activity of Yki
with different binding partners. We show that the cell-autonomous upregulation
of dMyc is required for the supercompetitive behavior of Yki-expressing
cells and Hpo pathway mutant cells, whereas the relative levels of dMyc
between Hpo pathway mutant cells and wild-type neighboring cells are critical
for determining whether cell competition promotes a tumor-suppressing
or tumor-inducing behavior. All together, these data provide a paradigmatic
example of cooperation between tumor suppressor genes and oncogenes
in tumorigenesis and suggest a dual role for cell competition during tumor
progression depending on the output of the genetic interactions occurring
between confronted cells.
Author Summary:
One of the major challenges of developmental biology and cancer research is to get a better understanding of how different signals regulate proper organ growth and prevent tumor formation. Even though there is a strong correlation between tumor progression and Myc family misexpression or Hippo signaling pathway malfunction, the relationship between these organ growth regulators remains unclear. Here, we demonstrate that the Hippo signaling pathway controls the transcription of Drosophiladmyc. Furthermore, we show that the misregulated expression of dMyc in Hippo mutant cells elicits their proliferative expansion at the expense of normal surrounding cells. These findings reveal a molecular mechanism of cooperation between oncogenes and tumor suppressor genes that favors both tumor progression and wild-type tissue elimination. Additionally, our findings indicate a dual role for cell competition during the tumour progression depending on the cellular context.
This work was supported by grants from Fondazione Cassa di Risparmio in Bologna to Annalisa Pession and Sandro Cavicchi, from the Italian AIRC (RG 6238) to Andrea Pession, and from NIH (SC1DK085047) to Paola Bellosta. Marcello Ziosi was a Fellow of the PhD Program in Biodiversity and Evolution, Università di Bologna, in the first part of the work and currently is supported by the Fondazione Cassa di Risparmio in Bologna. Luis Alberto Baena-López is supported by the Wellcome Trust Foundation, grant nr. 082694/Z/07/Z; Daniela Grifoni is supported by a Senior Research Fellowship, Università di Bologna, and Francesca Froldi is a Fellow of the PhD Program in Cellular Biology and Physiology, Università di Bologna. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Growth regulation requires the fine tuning between the rate of cell death and cell proliferation in developing organs. Studies in Drosophila have revealed that somatic cells within a growing epithelium compete with one another for contribution to the adult organ and this phenomenon, known as cell competition [1], is possibly conserved among organisms, for a review [2]. Cell competition was discovered several decades ago comparing the clonal growth parameters of Drosophila wild type cells (+/+) and slow-dividing Minute/+ cells [1]. From those analyses and recent data [3], it has been concluded that the contact between wild type and slow-growing cells, in genetic mosaics, favors the positive selection and clonal expansion of faster cells(winners) at the expense of slow-dividing ones (losers), although eventually the final number of cells in the organs is unaffected [3]. The biological function of cell competition remains unclear but it is thought to contribute to tissue homeostasis by coordinating the rate of cell proliferation and cell death [4], [5]. One of the best examples illustrating cell competition was obtained from the analysis of Drosophilamyc[4],[5], opening to the speculation that this phenomenon might play a role in tumorigenesis [2], [6], however the basis of cell competition in tumorous situations has just begun to be investigated [7]. dmyc is an evolutionarily conserved proto-oncogene associated with different cellular processes, including cell cycle progression, cell growth and apoptosis [8][11]. The function of dMyc protein is both necessary and sufficient to control rRNA synthesis and ribosome biogenesis [12]. In Drosophila, cells carrying hypomorphic alleles of dmyc are viable in a homotypic context, but they are outcompeted and excluded from the epithelium when surrounded by wild type cells [5]. By contrast, dmyc overexpressing cells become supercompetitors able to kill wild type surrounding cells [4], [5]. Remarkably, dMyc upregulation is related with many types of human cancers [13] and it favors the clonal expansion of cells carrying additional oncogenic mutations [14], [15].
During the last years, the Hippo (Hpo) tumor suppressor pathway has emerged as a safeguard system restricting organ growth and preventing hyperplastic disease in metazoans [16], [17]. Mutations in several members of this pathway have been associated with tumor formation both in Drosophila and in humans [18]. It has also been reported that mutations in many members of the Hpo pathway can rescue the viability of heterozygous M/+ cells in genetic mosaics [19], suggesting that these mutant cells behave as supercompetitors. Therefore the detailed analysis of Hpo pathway members appears to be an attractive model in which to evaluate the relationship between cell competition and tumor growth, as well as the molecular mechanisms required for this crosstalk. Hpo, Salvador (Sav) and Warts (Wts) constitute the core of the Hpo pathway that regulates by phosphorylation the downstream transcriptional co-activator Yorkie (Yki) [18], [20]. The hyperphosphorylated form of Yki is retained in the cytoplasm [21], [22], thereby preventing the expression of several target genes involved in cell proliferation control (Cyclin E, E2F1, bantam miRNA) [16], [23][25], cell death (dIAP1) [16] and cell signaling regulation (dally and dally-like) [26]. It has been demonstrated that Yki regulates its target genes by binding to Scalloped (Sd), a TEAD/TEF family transcription factor [27][30]. In addition, recent data indicate that Yki is also able to bind to the homeoprotein Homothorax (Hth) forming a complex which regulates the transcription of bantam in the eye disc [31]. The atypical cadherins Fat (Ft) [26], [32][37] and Dachsous (Ds) [20], [26], [33], [38], as well as the FERM-domain proteins Expanded (Ex) and Merlin (Mer) [39], have also been implicated in the pathway as upstream components. Although their biochemical functions are still uncertain, it is assumed that they converge on Wts to regulate Yki activity [40], [41].
Here we provide a detailed analysis of the autonomous and non-autonomous
effects on growth of yki-expressing cells and mutations of members
of the Hpo pathway. In addition we show that dmyc is a transcriptional
target of Yki, able to confer competitive properties to the Hpo pathway
mutant cells in the Drosophila wing. Furthermore, dmyc upregulation
is essential to sustain the high rate of cell proliferation of Hpo mutant
cells and to protect them from being eliminated in a competitive background.
Finally, we show that the relative levels of dMyc protein between
neighboring cells are critical in order to define the role of cell competition
during
tumor progression.
Results:
Hpo pathway mutant cells display supercompetitive properties
In order to analyze the competitive properties of Hpo pathway mutant
cells, we used mosaic analysis to compare the size of yki
overexpressing clones (hereafter referred to as ykiover)
with their wild type twins. While clones and twins showed a comparable
size in the wild type control (Figure 1A, 1F, and 1G,
and Figure S1A, S1C, S1D), ykiover clones were notably larger
than their wild type twins in wing discs dissected either 60h (Figure
1D, 1H, and 1I) or 48h (Figure S1B, S1E, S1F) after heat-shock induction.
Furthermore, ykiover wild type twins were almost disappeared from
the epithelium at 120h after egg laying (AEL) (Figure
1B and 1C). These differences in size were also prominent when discs
were dissected at 96h AEL (Figure 1D and 1E). Interestingly,
the clonal expansion of ykiover cells was also correlated with non-autonomous
apoptosis, as revealed by active Caspase 3 immunoreactivity of a subset
of surrounding wild type cells (Figure 1B1E). The size
advantage of ykiover clones and the induction of apoptosis in wild
type cells is consistent with the broadly assumed definition of cell
competition, which implies that the clonal expansion of the winner
cells occurs at the expense of the juxtaposed losers, that are eliminated
by apoptotic death
[2],
[42], [43].
The pattern of cell death in wild type and ykiover cells (Figure
1B1E) was not confined to the interface between the two cell
types; as can be seen in Figure 1E, cell death extends
several
cell diameters away and wild type cells tend to die massively
when enclosed between nearby mutant clones (Figure 1E,
yellow
arrowhead). A similar pattern of non-autonomous cell death was
observed in wild type cells nearby mutant clones for other members of the
Hpo pathway, such as ft and ex (Figure S2A,
S2B, S2C). Strikingly, ykiover clones and wts mutant clones grown
for a longer period presented autonomous cell death (Figure
1C, see active Caspase 3 staining, and Figure S2D), despite the upregulation
of anti-apoptotic molecules such as dIAP1 [16]; this
might be possibly due to either developmental constraints compensating
for excessive proliferation of the entire organ or toxicity caused by high
and constant levels of Yki. Altogether, these results confirm the previously
suggested supercompetitive properties of the Hpo pathway mutant clones[19]
by revealing their ability to overgrow and eliminate surrounding wild
type cells.
Figure 1. yki overexpression confers cells a supercompetitive
behavior.
Figure 1. yki overexpression confers cells a supercompetitive behavior.
(A) yw, hs-Flp, tub-Gal4, UAS-GFP; FRT42D, tub-Gal80/FRT42D, Ubi-GFP clones induced at 4872 h AEL. Twin clones are marked by the lack of GFP (0xGFP); imaginal discs were dissected at 120h AEL.
(BE) yw, hs-Flp,tub-Gal4, UAS-GFP; FRT42D, tub-Gal80/FRT42D, Ubi-GFP; UAS-yki/+ clones (2xGFP = 2XUbi-GFP+tub-GFP) sorrounded by wild type cells.
(B,D) Clones were induced at 2448 h AEL and dissected at 120 h AEL (B) or 96h AEL (D).
C and E are magnifications of B and D respectively. Cell death assayed by Caspase 3 staining is shown in red
(AE). Yellow arrowhead indicates a wild type twin in C (0xGFP), whereas the red arrowhead indicates wild type cells dying far from ykiover clones. Note that wild type cells preferentially die when enclosed by ykiover cells (yellow arrowhead in E).
(FI) Histograms showing the surface area of wild type and ykiover clones and respective twins induced at 4872 h AEL and allowed to grow until 120h AEL.
(F, G) Wild type clones (F) and their twins (G) display the same size profile.
(H) The size profile of ykiover clones indicates that they are larger either than wild type controls (F, G) or than their wild type twins (I).
Note also that wild type twins (I) of ykiover clones (H) are smaller than wild type clones induced at the same stage of development (F, G). SEM = Standard Error of the Mean. P<0.0001.
doi:10.1371/journal.pgen.1001140.g001
dmyc is a Hpo pathway target gene regulated by the activity of Yki
It is well documented that the confrontation of different levels
of dMyc protein between two populations of cells either in vivo[4],
[5]
or in cell culture [44] can trigger cell competition,
however the molecular mechanism by which this occurs is unknown. In addition,
myc
family oncogenes are frequently overexpressed in human cancers and it contributes
to tumor progression of YAP-expressing cells (mammalian orthologue of
yki) [17]. We have previously shown that a transcriptional
activation of dmyc occurs in ft mutant tissues and
that ft clones fail to grow in a dmyc hypomorphic
background [45], indicating a possible regulation of
this oncogene by the Hpo pathway. Moreover, the expression pattern of dMyc
is complementary to that of Ds in the wing imaginal disc (Figure
2A), suggesting a possible functional interaction. To validate this
hypothesis, we analyzed dMyc expression in mutant clones for several members
of the Hpo pathway and in ykiover cells by immunofluorescence. Noticeably,
we found that dMyc was upregulated in a cell-autonomous manner in ykiover
clones throughout the wing disc (Figure 2B and Figure
S3), with the weakest activation in the lateral regions, and in a subset
of clones mutant for several Hpo pathway members (Figure
2C2F). These differences in dMyc activation between ykiover
clones and clones mutant for other members of the Hpo signaling pathway
might be due to additional levels of regulation of the Hpo cascade operating
on upstream members. According to our previous observations, we would predict
a repression of dMyc upon Hpo pathway hyperactivation. To investigate this
hypothesis, we expressed Hpo in the spalt expression domain of the developing
wing disc. Since Hpo overexpressing cells die massively by apoptosis during
development [25], we coexpressed the anti-apoptotic factor
p35. As expected, cells coexpressing Hpo and p35 show reduced levels of
dMyc with respect to the control (Figure S4A) in both late (Figure S4B)
and early (Figure S4C) wing discs. Thus dMyc levels can be regulated by
the Hpo pathway activity.
Figure 2. dmyc oncogene is regulated by the Hpo pathway.
Figure 2. dmyc oncogene is regulated by the Hpo pathway.
(A) Double staining with anti-dMyc (red) and anti-Ds (green) reveals that dMyc and Ds proteins show a complementary pattern of expression in the wing disc; dMyc is highly expressed in the wing pouch and less in the notum, while Ds localizes mainly in the hinge and pleura, where dMyc expression is the lowest.
(B) dMyc staining of yw, hs-Flp; actFRTy+FRTGal4, UAS-GFP/UAS-yki Flp-Out clones (GFP+) show increased dMyc protein level.
(CF) dMyc protein levels are increased in dsd36, ftG-rv, exE1 and wtsX1 LOF clones (arrows). Clones were induced by the Flp/FRT system and are marked by the lack of GFP (0xGFP). Clones were induced at 4254 h AEL (CF) or at 5466 h AEL (B).
doi:10.1371/journal.pgen.1001140.g002
dmyc is transcriptionally regulated by Yki
dmyc was observed upregulated in RT-PCRs performed on ft
mutant imaginal discs [45], suggesting that it could
be a transcriptional target of the Hpo pathway. In order to investigate
this, we first performed an in situ hybridization in Drosophila
wing discs expressing yki under the control of the decapentaplegic (dpp)
promoter. As expected, dmyc transcript is detectable in the dpp
domain both in yki and control dmyc-expressing discs (Figure
3A). No signal within the dpp domain was detected in dpp>GFP control
discs (not shown). We were able to reproduce these data using a dmyc>lacZ
line [46] which recapitulates accurately the dmyc
pattern throughout the wing disc during development [7],
[47].
As can be seen in Figure 3B, the ßGal expression
is increased in the dpp domain upon yki expression, indicating that
Yki acts upon dmyc transcription. This result was supported using
clonal analysis, both in
ykiover cells, as shown in Figure
3C, and in cells mutant for ft (Figure S5). Altogether,
these data demonstrate the ability of the Hpo pathway to regulate dmyc
transcription in the imaginal wing disc.
Figure 3. Yki regulates dmyc transcription.
Figure 3. Yki regulates dmyc transcription.
(A) In situ hybridization on imaginal wing discs with a full-length dmyc RNA probe. The dmyc transcript is robustly upregulated in the dpp>yki disc on the left. A dpp>dmyc disc is shown on the right as a control.
(B) ßGal staining (red) of dmyc>lacZG0354/+; dpp>Gal4, UAS-GFP/UAS-yki imaginal wing discs. dmyc expression is upregulated in the dpp domain (GFP+).
(C) ßGal staining (red) of dmyc>lacZG0354/hs-Flp; actFRTy+FRTGal4, UAS-GFP/UAS-yki imaginal wing discs. ykiover clones (GFP+) were induced at 4254h AEL. As can be observed, a robust activation of dmyc regulatory sequences is visible within the mutant clones.
(D,E) dMyc staining of yw, hs-Flp/+; UAS-sd/+; actFRTy+FRTGal4, UAS-GFP/UAS-yki and yw, hs-Flp/+; UAS-sd/+; actFRTy+FRTGal4, UAS-GFP/+ imaginal wing discs respectively. Clones (GFP+) were induced at 4254 h AEL. As can be observed in E, dMyc levels are comparable inside and outside the mutant clones.
(F) dMyc staining of yw, hs-Flp/+; UAS-sd-RNAi/+; actFRTy+FRTGal4, UAS-GFP/UAS-yki imaginal wing discs. Clones (GFP+) were induced at 4254 h AEL. No clones in the wing pouch region were recovered and those outside the wing pouch never took the tumorous shape typical of ykiover clones. All larvae were dissected at 120h AEL.
(G) dIAP1 Hpo Responsive Elements (HRE) for Yki/Sd complexes are indicated in red [28]. The same consensus sites are found twice in the second intron of dmyc both in D. melanogaster and D. simulans, indicating a possible functional conservation.
(H) Scheme of the dmyc locus showing the exons (E) and introns (I). The red bar indicates the region of the second intron containing the putative Yki/Sd consensus sites.
(I) Luciferase assay on S2 Drosophila cells. NT: cells transfected with dmyc-firefly alone. P value is significative for Sd/Yki (P<0,05) and Yki (P<0,01). Error bars represent standard deviation (triplicate wells).
doi:10.1371/journal.pgen.1001140.g003
Yki transcriptional activity depends on the formation of tissue-specific complexes with different partners such as Scalloped and Homothorax [27][31]. In order to study the contribution of Sd to dmyc upregulation by Yki in the wing disc, we generated ykiover clones coexpressing either a UAS-sd or a UAS-sd-RNAi construct (see Figure S6A for validation). As can be seen in Figure 3D, sdover; ykiover clones overgrew relative to ykiover clones (compare with Figure 2B, 68% increase on average, n = 27, P<0,005) confirming previous data [29], but we were not able to detect significant differences in dMyc protein levels compared to ykiover clones (n = 22, P = 0,43). As expected, control sdover clones did not overgrow and did not deregulate dMyc (Figure 3E), demonstrating that Yki is required for dMyc upregulation. We were not able to recover sd-RNAi; ykiover clones in the wing pouch region, but clones generated in other territories of the wing disc, although large, did not upregulate dMyc (Figure 3F), nor showed the same degree of hyperplasia as Yki expression alone (Figure 1B1E). sd-RNAi control clones were very small and did not deregulate dMyc (not shown). These data indicate a key role for Sd in vivo in upregulating dMyc in ykiover clones, and in contributing to the ykiover tumorous phenotype.
Interestingly, examination of dmyc locus revealed the existence of several CATTCCA repeats in non-coding regions of the gene, which perfectly match the mammalian [48], [49] and Drosophila [28], [29] TEAD/TEF family transcription factor consensus binding motifs (mammaliam orthologues of Scalloped). In addition, these putative binding motifs for Yki/Sd complexes are evolutionarily conserved in D. simulans (Figure 3G) and relatively close to the insertion point of P elements that recapitulate the endogenous expression of the gene (dmPL35 LacZ [50], [51] and dmBG02383 Gal4 insertions - http://flybase.org/reports/FBti0018138.html ).
To test the significance of these sequences in dmyc regulation, we generated a dmyc-firefly reporter containing the putative responsive elements for Yki/Sd complexes (Figure 3H) and performed a transient dual luciferase assay in S2 cells. As can be seen in Figure 3I, the reporter was specifically activated upon Sd and Yki cotransfection but, unexpectedly, the transfection of Yki alone was able to activate the reporter as efficiently as the cotransfection Yki/Sd (Figure 3I). This result suggests that in presence of high levels of Yki alone, additional partners such as Hth [31] could bind it and co-regulate dmyc expression.
Indeed, complementarily to Yki/Sd complexes, Yki/Hth complexes seemed to play the same role in the presumptive thoracic region of the wing disc. Supporting this conclusion, hth-RNAi; ykiover clones down-regulated dMyc in the notum (30% reduction on average, n = 15, P<0,05, Figure S6B, yellow arrows) and did not grow as tumors in that region. By contrast, they were undistinguishable from ykiover clones in the wing pouch region (Figure S6B, white arrowhead), where Hth expression is almost undetectable (Figure S6C). Altogether, these latter results indicate that Sd and Hth play a role in Yki-induced tumorigenesis by regulating dmyc expression in the wing disc, with Sd playing a more critical role in the pouch and Hth acting in the presumptive thorax.
dMyc upregulation enhances cell proliferation of the Hpo pathway mutant cells in an autonomous manner
With the aim to investigate the cell-autonomous contribution of dMyc
overexpression to ykiover phenotypes, we first compared the size of ykiover
clones with that of ykiover; dmyc-RNAi clones (Figure
4, see also Figure S7A, S7A', and [7] for RNAi construct
validation ). As expected, dmyc-RNAi clones showed a reduced number
of cells with respect to that observed in wild type clones (21% reduction
on average, compare Figure 4B and 4B' with Figure
4A and 4A', P<0.01). The reduction in cell number displayed
by the ykiover; dmyc-RNAi clones with respect to the ykiover
clones was even more evident (43% reduction on average, compare Figure
4D and 4D' with Figure 4C and 4C', P<0.01), and this percentage
raised up to 65% (n = 87, P<0,001) when these clones were
induced earlier in development (4254h AEL), indicating a strong cell-autonomous
requirement of dMyc protein for the expansion of ykiover clones.
We also observed that the non-autonomous apoptosis induced by yki overexpression
was reduced upon dmyc deprivation (32% on average, n = 28, P<0,01,
Figure S7B). These data suggest that dMyc upregulation promotes cell proliferation
of ykiover clones in an autonomous manner, and also promotes their
competitive behavior.
Figure 4. dMyc boosts the proliferative abilities of ykiover
cells.
Figure 4. dMyc boosts the proliferative abilities of ykiover cells.
Four types of clones were simultaneously induced through the Flp-Out system at 4872h AEL and allowed to grow for a comparable period (until 120h AEL). Clones are GFP+, nuclei are counterstained with DAPI.
(AA') act>GFP control clones.
(BB') act>dmyc-RNAi clones.
(CC') act>ykiover clones proliferate faster than wild type clones.
(DD') act>dmyc-RNAi; ykiover clones: proliferation is reduced relative to act>ykiover clones. (A'D') Histograms showing the number of cells/clone of the genotypes indicated in AD. SEM = Standard Error of the Mean. P<0.01.
doi:10.1371/journal.pgen.1001140.g004
To further characterize this proliferation-promoting effect of dMyc,
we compared the clonal behavior of various mutations in members of the
Hpo pathway grown in two different genetic backgrounds: a wild type context
and a genetic background overexpressing dmyc under the control of
a hedgehog promoter in the posterior (P) compartment of the wing
disc. We found that ft, ex and ds
mutant clones were consistently larger in those territories expressing
uniform levels of dMyc than in the wild-type background (Figure
5 and Figure S8). It is however described that the overexpression of
dMyc is able to autonomously increase apoptosis [8][11].
In fact, the wild type tissue expressing high amounts of dMyc tends to
die and does not overgrow (see active Caspase 3 stainings in Figure
5A and 5D). Noticeably, the apoptosis mediated by dMyc overexpression
seems to be extremely reduced inside ft and ex clones (Figure
5A and 5D) with respect to the wild type surrounding territories, likely
due to the upregulation of antiapoptotic genes such as dIAP1, a
target of the Hpo pthway
[20]. In addition, the dying
cells in this genetic background might induce morphogens to promote compensatory
proliferation [52] that may contribute to the extra-growth
of ft- or ex-UAS-dmyc expressing clones. To
circumvent this problem, we repeated the same experiment coexpressing
dmyc
and dIAP1. As can be seen in Figure S9, both ft (Figure
S9A) and ex (Figure S9D) mutant clones grown in the P compartment
were still consistently larger than those originated in the A compartment,
thus confirming a specific cooperation of dmyc and Hpo pathway mutants
in clonal expansion.
Figure 5. dMyc overexpression enhances the proliferation of Hpo
pathway mutant cells.
Figure 5. dMyc overexpression enhances the proliferation of Hpo pathway mutant cells.
ft (AC) and ex (DF) LOF clones (0xGFP) generated in a background where posterior (P) cells ectopically express dmyc under the control of hh-Gal4 (A and P compartments are separated by a yellow line in A and D; P is on the right). dMyc overexpression strongly enhances the proliferative activity of ft (AC) and ex (DF) mutant cells; mutant clones are larger in dMyc-expressing territories (P compartment in histograms C and F) than in a wild type background (A compartment in histograms B and E). SEM = Standard Error of the Mean. P<0.001. High levels of active Caspase 3 signal are evident in dMyc-expressing cells outside ft and ex mutant clones in the posterior compartment.
doi:10.1371/journal.pgen.1001140.g005
Hpo mutant cells therefore seem to show the ability to take advantage of the cell mass accumulation boosted by dMyc overexpression to proliferate faster.
dMyc upregulation prevents the Hpo pathway mutant clones from being restrained in a competitive background
To address the non-autonomous relevance of dmyc upregulation
in providing ykiover cells with a supercompetitive behavior, we
compared the size of ykiover clones generated in a wild type background
to that of ykiover clones generated in a background ubiquitously
overexpressing dmyc under the control of a tubulin (tub)
promoter (cell competition assay, [4], [5]).
In this assay cells express the endogenous dmyc gene plus an extra
copy of the gene under the control of a tub promoter that ensures
two-to-threefold increase of dmyc transcript [5]. This
extra copy of dmyc is located in a removable cassette between the
tub promoter and a Gal4 cDNA. Upon dmyc cassette excision, the tub
promoter drives Gal4 expression in the clones and, as a result, those cells
express lower levels of dmyc relative to the background and are
rapidly eliminated from the tissue by cell competition. Only few genes
have so far been found whose overexpression rescues cell viability in this
context [5]. The relative difference in dMyc levels between
yki-expressing
cells and the surrounding tub>dmyc cells was minimized in
a competitive background compared to a wild type context (compare Figure
S7C and S7C? with Figure 2B). In this competitive background,
ykiover
clones showed a diminished ability to overgrow compared to a wild type
background (44% reduction on average, compare Figure 6C and
6C' and Figure 6B and 6B'; P<0,01). Besides
the reduction in size, ykiover clones showed an important reduction
in clone number both in discs (Figure 6C) and adult wings
(compare Figure S7E to Figure S7D). Moreover, ykiover clones induced
earlier in development (4254h AEL) were never recovered at the end of
larval development (not shown). These data indicate that the competitive
properties of ykiover cells are extremely reduced when they are
surrounded by cells expressing very high amounts of dMyc.
Figure 6. ykiover clonal expansion is restrained by dmyc-induced
cell competition.
Figure 6. ykiover clonal expansion is restrained by dmyc-induced cell competition.
(AD') Cell competition assay shows that, while wild type clones are outcompeted in this genetic background [5], the clonal expansion of ykiover cells is partially restrained. Clones were induced at 6084 h AEL and allowed to grow until 120h AEL. Clones are GFP+, nuclei are counterstained with DAPI.
(AA') wild type control clones generated through a tubulin (tub) Flp-OUT system.
(BB') ykiover clones generated with the same system as the wild type control.
(CC') ykiover clones in a tub>dmyc background are smaller than in a wild type background. P<0.01.
(DD') dmycPL35/+; tub>ykiover clones in a tub>dmyc background are smaller than in C (P<0.01), confirming that the relative dMyc levels outside vs inside the clones affect the competitive ability of ykiover cells.
(A'D') Histograms showing the number of cells/clone of the genotypes indicated in AD. In C and D discs are larger due to the overall increase in body size of tub>dmyc individuals [59] SEM = Standard Error of the Mean.
doi:10.1371/journal.pgen.1001140.g006
We then performed the same competition assay as before while reducing dmyc activity inside the clones. We used the pupal lethal dmycPL35 allele [49] and, taking advantage of dmyc locus association to chromosome X, we were able to analyze both female (heterozygous condition, the expression of dmyc is halved) and male (hemizygous condition, the expression of dmyc is completely removed) larvae. In dmycPL35/+; tub>dmyc females, ykiover clones were smaller than those described in the previous assay (28% reduction on average, compare Figure 6D and 6D' to Figure 6C and 6C', P<0,05), whereas they were completely outcompeted by 48h after the heat shock in males (not shown). Since it has been observed that a dmycPL35 heterozygous condition does not impair cell growth or proliferation rate [49], our results reveal an important role for dmyc-induced cell competition in controlling the clonal expansion of ykiover cells, which may occur via their non-autonomous capabilities to compete with neighboring wild type cells.
dMyc expression alone is not sufficient to prevent the elimination of yki mutant cells
yki LOF clones generated in a wild type background are not able to
grow [16], [25] and the ectopic expression
of the antiapoptotic proteins dIAP1 [25] or p35 (Figure
S10A) poorly rescues their viability, whereas a Minute background
[53]
or bantam overexpression within yki clones has been shown
to partially rescue their growth [25]. Since our results
have indicated that dmyc participates in tumor growth of the Hpo
pathway mutant cells, we therefore analyzed if the expression of dMyc was
sufficient to prevent the death of yki mutant cells. The overexpression
of dMyc failed to rescue the viability of yki-/- cells (Figure S10B).
Since yki mutant cells express low levels of the apoptosis inhibitor
dIAP1 (not shown), this result is not surprising, considering the autonomous
cell death described for cells overexpressing dMyc [11].
However, yki mutant cells coexpressing dMyc and p35 also failed
to grow (Figure S10C). The lack of expression of additional antiapoptotic
genes and cell cycle regulators [18] possibly
impedes the clonal growth of yki mutant cells even though they overexpress
dMyc. This result suggests that dmyc expression is able to enhance
the ability of Hpo pathway mutant cells to grow, but it is not sufficient
to rescue tissue growth of yki-/- clones.
Discussion:
Cells within a tissue coordinate and execute complex genetic programs in order to succeed in completing a variety of processes during development. In this context, the phenomenon of cell competition may be part of the developmental plan that ensures removal and replacement of defective cells in growing organs, thus keeping their size invariant. In this work, we have evaluated in details the relationships between the phenomenon of cell competition and the clonal expansion of tumorous cells, using for that purpose mutants in components of the evolutionarily conserved Hpo pathway. From our studies we reveal that the Hpo pathway regulates dMyc expression, and show that this is critical for the tissue growth and competitive behavior of Hpo pathway mutant clones.
dMyc is a Hpo pathway transcriptional target
dmyc upregulation has been demonstrated in many studies to provide cells with supercompetitive properties [4], [5], [7]. The model explaining how dMyc can confer competitive properties to cells is based on the relative levels of this protein in neighboring cell populations, transforming those cells expressing higher levels of dMyc into supercompetitors [4], [5]. dmyc overexpression is nevertheless insufficient to drive tumorous growth; dmycover clones fail to overproliferate and show strong autonomous apoptosis [9]. Interestingly, we found that dMyc protein is overexpressed in Hpo pathway mutant clones, indicating an involvement for this cascade in dmyc regulation (Figure 2). Furthermore, the upregulation of dMyc in Yki-expressing cells correlates with an increase in the amount of mRNA, observed by in situ hybridization (Figure 3A) and using a dmyc>lacZ line (Figure 3B and 3C). Finally, we have identified a regulatory region in the second intron of dmyc that is sensitive to Yki abundance; importantly, this regulatory region includes predicted consensus-binding motifs for Sd (Figure 3H). Clonal experiments in the wing disc indicate that Sd is necessary for Yki function in vivo, since upon Sd downregulation Yki is no longer able to induce tumorous growth and does not upregulate dMyc (Figure 3F). All these findings support the notion that there is a transcriptional regulation of dMyc mediated by Yki/Sd complexes in the wing pouch. Importantly, similar results were observed for dMyc regulation in the notum by Yki/Hth complexes, suggesting that tumor growth and dmyc regulation are tissue-specific.
What is the contribution of dMyc to the Hpo pathway mutant phenotypes?
We found that dMyc upregulation is a common feature of Hpo pathway mutant cells. Since dmyc has been repeatedly associated with tumor progression and cell competition, we analyzed its role in the clonal expansion of Hpo pathway mutant cells. We observed that the reduction of dMyc expression restricts the ability of Hpo pathway mutant cells to proliferate (Figure 4), whereas its uniform overexpression strongly promotes their proliferation (Figure 5). Furhermore, while dMyc-expressing wild type cells surrounding mutant clones are rapidly eliminated by autonomous apoptosis, Hpo pathway mutant cells are able to take advantage of dMyc role in protein biosynthesis and cellular growth to divide rapidly. This is a clear example of functional cooperation between different genes in order to favor tumor progression, but it also indicates a specific role of dMyc in promoting the clonal expansion of Hpo pathway mutant cells. According to these data, we conclude that dMyc behaves as a growth-promoting factor which sustains the hyperplastic phenotype of Hpo pathway mutant cells. Importantly, this specific cooperation might be evolutionarily conserved, since c-myc appears to be upregulated in a murine model of YAP-induced carcinoma [17].
Relative levels of dMyc in neighboring cells restrict/promote clonal expansion of hyperplastic cells, likely through cell competition
It has been suggested that cell competition may be a mechanism potentially
restricting the clonal expansion of tumorous cells [7],
but it might also help faster proliferation of transformed cells. Our data
indicate that Hpo pathway mutant cells are able to use high levels of dMyc
to proliferate rapidly (Figure 5), but in a competitive
context, where neighboring cells express high levels of dMyc, clonal expansion
of ykiover cells is restrained (Figure 6), therefore
suggesting a tumor suppressor role for cell competition. Conversely, dMyc
upregulation in ykiover clones grown in a wild type background favors
their clonal expansion promoting cell autonomous proliferation and also
conferring the ability to outcompete sourrounding cells in a non-autonomous
manner. These findings suggest that the phenomenon of cell competition
may play a dual role in tumor progression depending on the output of the
genetic interactions occurring between adjacent cells.
In summary, we have shown a tumor-braking gene network in
Drosophila
epithelia which tightly controls cell proliferation, apoptosis and cell
competition via the Hpo pathway and dMyc expression. Importantly,
YAP deregulation has been reported in several types of human cancers [54][56],
therefore the mechanism of clonal expansion of Hpo pathway mutant cells
in Drosophila might be relevant to understand tumor progression
in mammals.
Materials and Methods:
Genotypes and clonal analysis
The fly strains used in the present work were obtained by the Bloomington Stock Center and are described at http://flybase.bio.indiana.edu. The following strains were instead obtained by: w; UAS-yki (D Pan); yw, tubFRTdmycFRTGal4 and yw, dmycPL35, actFRTy+FRTGal4 (P Gallant); w, hs-FLP; actFRTy+FRTGal4, UAS-GFP (B Edgar); w; FRT40A, dsD36 (I Rodríguez). The UAS-RNAi constructs for dmyc, sd and hth were obtained from the VDRC.
All experiments were carried out at 25°C unless otherwise indicated.
MARCM UAS-yki twin-spot clones were induced at different stages of development by a 35-minutes heat shock at 37°C and larvae of the following genotype were dissected at either 84-100h AEL or 120h AEL: yw, hs-Flp, tub-Gal4, UAS-GFP; FRT42D, tub-Gal80/FRT42D, Ubi-GFP; UAS-yki/+. Clones of the same genotype were induced 5466 h AEL and dissected 48h after a 20-minutes heat shock (Figure S1). For FRT-Flp twin analysis, the following hypomorphic or null alleles were used: dsD36, ftG-rv, exE1, wtsX1, ykiB5. Loss-of-function clones of ds, ft, ex and wts in either wild-type or mutant backgrounds overexpressing different transgenes in the posterior compartment were induced at 4872h AEL by 1 hour heat shock at 37°C. Larvae of the following genotype were dissected at 120h AEL:
yw, hs-Flp; FRT40A, Ubi-GFP/FRT40A, dsD36 or ftG-rv or exE1
yw, hs-Flp; FRT82B, Ubi-GFP/FRT82B, wtsX1
yw, hs-Flp; FRT40A, Ubi-GFP/FRT40A, dsD36 or ftG-rv or exE1; hh-Gal4/UAS-dmyc
yw, hs-Flp; FRT40A, Ubi-GFP/FRT40A, ftG-rv or exE1; hh-Gal4/UAS-dmyc, UAS-dIAP1
The size of non-confluent clones was measured drawing each Z-stack of the confocal images using ImageJ software ( http://rsbweb.nih.gov/ij ). Afterwards the area of the clones was normalized dividing by the area of the wing pouch, considered as the territory encircled by the first outer folding of the wing. In Figure S1, the narrower window of clonal induction allowed us to compare clonal size without size normalization respect to the wing pouch. Statistical analysis was performed with Microsoft Excel and R (http://www.r-project.org). Statistical significance was determined by two tailed Student's t test and reported as the associated probability value (P).
Flp-Out clones were induced at 60h AEL by a 8-minutes heat shock at 37°C; imaginal discs of the following genotype were dissected at 120h AEL:
yw, hs-Flp; actFRTy+FRTGa/4, UAS-GFP
yw, hs-Flp; UAS-dmycRNAi/+; actFRTy+FRTGa/4, UAS-GFP/+
yw, hs-Flp; actFRTy+FRTGa/4, UAS-GFP/UAS-yki
yw, hs-Flp; UAS-dmycRNAi/+; actFRTy+FRTGa/4, UAS-GFP/UAS-yki.
yw, hs-Flp/w, dmyc>lacZG0354; actFRTy+FRTGa/4, UAS-GFP/UAS-yki.
Cell competition assays were performed at 72h AEL inducing a 40-minutes heat shock at 36°C. Larvae of the following genotype were dissected at 120h AEL:
yw, tubFRTy+FRTGa/4/hs-Flp; UAS-GFP/+
yw, tubFRTy+FRTGal4/hs-Flp; UAS-GFP/+; UAS-yki/+
yw, tubFRTdmycFRTGal4/hs-Flp; UAS-GFP/+; UAS-yki/+
yw, dmycPL35, hs-Flp, tubFRTdmycFRTGa/4/+-Y; UAS-GFP/+; UAS-yki/+.
MARCM yki clones overexpressing p35, dMyc or both were generated at 4872h AEL by a 45-minutes heat shock at 37°C and larvae were dissected 48h later.
Immunofluorescence
Immunostainings were performed using standard protocols. The following primary antibodies were used: mouse anti-dMyc (1:5, P Gallant), mouse anti-En (1:50, DSHB), rabbit anti-active Caspase 3 (1:100, Cell Signaling Technology), rabbit anti-p35 (1:1000, Stratagene), rabbit anti-Ds (1:100, D Strutt), rabbit anti-Hth (1:400, A Salzberg, [57]), mouse anti-dIAP1 (1:100, B Hay) and rabbit anti-ßGal (1:400, F Graziani). Anti-mouse and anti-rabbit Alexa Fluor 555 (1:200) (Molecular Probes) and anti-mouse Cy5 (1:200) (Jackson Laboratories) against corresponding primary antibodies were used as secondary antibodies. Imaginal discs were mounted in Vectashield (Vector Laboratories) for confocal imaging. Single Z stacks were acquired with Leica SP2 and SP5 confocal microscopes. Images for Figure 4 and Figure 6 were captured with an epifluorescence Nikon 90i microscope. Entire images were elaborated with Photoshop CS2 (Adobe) and the projections along the Z axis were rebuilt starting from 3555 Z stacks using the ImageJ public software (NIH). For measurements of dMyc abundance, fluorescence intensity was calculated using the ImageJ public software (NIH) as the average gray value within selectioned portions of confocal Z stacks. For measurement of active Caspase 3 signal outside UAS-dmyc-RNAi; UAS-yki and UAS-yki clones, staged wing discs were chosen containing as few clones as possible and single cells positive to active Caspase 3 observed at a maximum distance of five nuclei (counterstained with DAPI) from the border of the clone were counted on confocal Z stacks. In situ hybridization was performed with a full length dmyc probe [9] on wing imaginal discs of L3 larvae expressing UAS-GFP, UAS-dmyc or UAS-yki under the control of dpp-Gal4. RNA in situ hybridization was carried out using digoxigenin-labeled RNA probes [58].
Luciferase transient expression assays
Drosophila S2 cells were grown at 25°C in Schneider medium (GIBCO) supplemented with 10% heat-inactivated FCS and 100 units of penicillin.
1189 base pairs located in the second intron of the dmyc sequence (Figure 3H) were subcloned into a pGL3-firefly vector (Promega) and co-transfected with Sd and/or Yki-expressing pAc5.1/V5-HisB plasmids [28] using Effectene Qiagen Transfection Kit. The primers used for that purpose were:
5' CAGCGGTACCAGTTTGCTGTCCTCTGC 3'
5'GCACTCTAGAGCCATGCGGAATTGTGCG 3'.
The PCR product was first cloned in pCR 2.1 TOPO-TA (Sigma) and then
subcloned in KpnI/XhoI sites of pGL3 Promoter vector. For luciferase transient
expression assays, 2×104 cells were plated in 96-well dishes. Cells
were harvested at 48 hours after transfection and luciferase activity was
measured using the Dual-Luciferase reporter assay system (Promega). Dual-Luciferase
measurements were performed using a FLUOstar Optima luminometer (BMG Labtech)
and normalized to the Renilla luciferase activity using pAct5C-seapansy
as an internal control. All transient expression data reported in this
paper represent the means from three parallel experiments, each performed
in triplicate. Average relative luciferase activity was graphed and statistically
analyzed by the Student's t-test.
Supporting Information:
Figure S1.
ykiover cells supercompetitive behavior is indeed visible at 48h after induction.
(A,B) yw, hs-Flp, tub-Gal4, UAS-GFP; FRT42D, tub-Gal80/FRT42D, Ubi-GFP (A) and yw, hs-Flp,tub-Gal4, UAS-GFP; FRT42D, tub-Gal80/FRT42D, Ubi-GFP; UAS-yki/+ (B) clones induced at 5466h AEL and dissected 48h after the heat-shock. Wild type and ykiover clones are GFP2+ and twin clones are marked by the lack of GFP. Cell death is assayed by active Caspase 3 inmunoreactivity in red. Note that cell death is almost absent in the wild type experiment (A') and marks wild type cells in the ykiover experiment (B'). (CF) Histograms showing the surface area of wild type and ykiover clones and respective twins. (C,F) Wild type clones (C) and their twins (D) display the same size profile. (E) The size profile indicates that ykiover clones are larger than wild type controls (C) as than their wild type twins (F) after only 48h of growth in the wing. SEM = Standard Error of the Mean. P<0.0001.
(1.60 MB TIF)
Figure S2.
Hpo pathway LOFs induce cell competition.
(A,B) Activated Caspase 3 staining of yw, hs-Flp/+; ftG-rv, FRT40A/Ubi>GFPnls, FRT40A discs in which mutant clones (0xGFP) were grown for 48 hours (4896 in A and 72120 in B); apoptotic cell death occurs mainly in wild type cells surrounding the mutant clones (arrowheads). (C,D) Activated Caspase 3 staining of yw, hs-Flp/+; exE1, FRT40A/Ubi>GFPnls, FRT40A (C) and hs-Flp/+; wtsX1, FRT82B/Ubi>GFPnls, FRT82B (D) discs in which mutant clones (0xGFP) were grown for a longer period (48108 and 48120 hours respectively); apoptotic death is visible in both wild type (D, arrowheads) and mutant (D, arrows) cells.
(2.75 MB TIF)
Figure S3.
dMyc upregulation in ykiover clones is cell-autonomous.
dMyc staining in yw, hs-Flp/+; actFTRy+FRTGal4, UAS-GFP/UAS-yki imaginal wing discs. ykiover clones (GFP+, in green) express high levels of dMyc (in red) compared to the endogenous background. Z-section indicates that dMyc (in red) up-regulation is confined to yki-expressing cells (in green).
(0.51 MB TIF)
Hpo overexpression reduces dMyc protein levels.
(A) dMyc staining in w; sal>Gal4/+; UAS-p35/+ imaginal wing discs. (BC) dMyc staining of late (B) and early (C) w; sal>Gal4/+; UAS-Hpo/+; UAS-p35/+ imaginal wing discs. p35 is shown in the green channel and dMyc in red. As can be observed in the Z-sections dMyc abundance is lower inside the sal domain. The position of Z-section is indicated by white bars in the surface view of the wing discs.
(2.76 MB TIF)
Figure S5.
dmyc is transcriptionally upregulated in ft mutant clones.
ßGal staining (red) of dmyc>lacZG0354/hs-Flp; ftG-rv, FRT40/UbiGFPnls, imaginal wing discs. As can be observed, a robust activation of dmyc regulatory sequences is visible within the mutant clones (arrows). Larvae were dissected at 120h AEL.
(0.93 MB TIF)
Figure S6.
Hth is necessary for Yki-induced dMyc overexpression in the presumptive thoracic region of the wing disc.
(A) Wing from a w; UAS-sd-RNAi/en>Gal4 individual. For UAS-sd-RNAi line validation, we induced the expression of the sd-RNAi construct in the posterior compartment of the wing by means of the engrailed (en) promoter. As can be observed, the wing lacks the posterior compartment (green-colored in the insert).
(B) dMyc staining in yw, hs-Flp/+; UAS-hth-RNAi/+; UAS-yki/actFTRy+FRTGal4, UAS-GFP imaginal wing discs. Note that mutant clones (GFP+) overgrow and overexpress dMyc in the wing pouch region (white arrowhead) and not in the notum region (yellow arrows).
(C) For UAS-hth-RNAi line validation, we stained for Hth [57] yw, hs-Flp/+; UAS-hth-RNAi/+; actFTRy+FRTGal4, UAS-GFP/+ wing discs. Hth expression is lacking in the clone originated in the pleural region (arrow).
(1.49 MB TIF)
Figure S7.
dmyc is involved in the competitive ability of yki.
(A) dMyc levels are strongly affected inside dmyc-RNAi; ykiover clones. (A?) A projection along the Z axis of the clone presented in Figure A is shown. The percentage of dMyc abundance reduction inside the mutant clones calculated as the abatement of fluorescence intensity (see Methods - Immunofluorescence) with respect to the neighboring tissue was 62% on average (n = 12).
(B) dmyc-RNAi; ykiover clones display a reduced non-autonomous apoptotic activity (yellow arrows, see Methods - Immunofluorescence - for calculation) compared to ykiover clones (see Figure 1).
(C) ykiover clones can compete in a high dmyc level background, where wild type clones fail to grow; clones were induced at 6678h AEL and allowed to grow until 120h AEL. In red, staining for dMyc indicates that dMyc levels are quite similar inside the ykiover clone and in the tub>dmyc background. (C?) A projection along the Z axis of the clone presented in figure C is shown.
(DE) In adult wings, tub>ykiover clones generated in a wild type background (D) are bigger than tub>ykiover clones generated in a tub>dmyc background (red arrows, E) confirming the results illustrated in Figure 6. Clones were induced at 6678h AEL and survived up to the adult stage.
(1.18 MB TIF)
dMyc overexpression boosts proliferation in ds mutant cells.
(A) ds LOF clones (0xGFP) generated in a background where posterior cells ectopically express dmyc under the control of the hh promoter (on the right). dMyc overexpression strongly enhances the proliferative activity of ds mutant cells; mutant clones are larger in dMyc-expressing territories (posterior compartment in C) than in a wild type background (anterior compartment in B). SEM = Standard Error of the Mean. P<0.001.
(0.67 MB TIF)
Figure S9.
dMyc overexpression boosts proliferation of Hpo pathway mutant cells also when wild type cells are protected from cell death.
ft (AC) and ex (DF) LOF clones (0xGFP) generated in a background where posterior (P) cells ectopically coexpress dmyc and dIAP1 under the control of hh-Gal4 (A and P compartments are separated by a white line in A and D; P is on the right). dMyc overexpression enhances the proliferative activity of ft (AC) and ex (DF) mutant cells; mutant clones are larger in dMyc-dIAP1 expressing territories (P compartment in histograms C and F) than in a wild type background (A compartment in histograms B and E). All panels show Caspase 3 staining in red and dIAP1 in blue. SEM = Standard Error of the Mean. P<0.001.
(2.59 MB TIF)
Figure S10.
dmyc fails to rescue yki LOF upon inhibition of cell death. Three types of yki LOF clones were induced through the MARCM system. In (A), yki mutant clones were generated while overexpressing the antiapoptotic protein p35 (in red). (B) Overexpression of dmyc fails to rescue yki mutant cells viability and Caspase 3 activation (red arrows). (C) The overexpression of p35 and dmyc together also fails to rescue yki mutant cells viability.
(1.47 MB TIF)
We thank A Baonza, A Garcia-Bellido, G Gargiulo, and JP Vincent for
scientific support. Thanks to L Quinn for sharing information about the
expression of the dmyc>lacZG0354 line prior to publication that
was helpful for our analysis in this paper and our previous publication
[7].
We thank L Johnston for having hosted us in her laboratory to perform part
of the experiments on S2 cells. We are grateful to HE Richardson, FA Martín,
and G Perini for manuscript revision and constructive criticisms. We finally
thank L Johnston, D Strutt, PJ Briant, P Gallant, FA Martín, G Morata,
D Pan, I Rodriguez, BA Hay, F Graziani, A Salzberg, the Bloomington Stock
Center, and the VDRC for flies and reagents.
Author Contributions:
Conceived and designed the experiments: Marcello Ziosi, Luis Alberto
Baena-López, Daniela Grifoni, Flavio Garoia. Performed the experiments:
Marcello Ziosi, Luis Alberto Baena-López, Daniela Grifoni, Francesca
Froldi. Analyzed the data: Marcello Ziosi, Luis Alberto Baena-López,
Daniela Grifoni, Francesca Froldi, Vincenzo Trotta, Sandro Cavicchi, Annalisa
Pession. Contributed reagents/materials/analysis tools: Andrea Pession,
Paola Bellosta. Wrote the paper: Marcello Ziosi, Luis Alberto Baena-López,
Daniela Grifoni, Andrea Pession.
References:
1. Morata G, Ripoll P (1975) Minutes: mutants of Drosophila
autonomously affecting cell division rate. Dev Biol 42: 211221. Find this
article online
2. Moreno E (2008) Is cell competition relevant to
cancer? Nat Rev Cancer 8: 141147. Find this article online
3. Martín FA, Herrera FC, Morata G (2009) Cell
competition, growth and size control in the Drosophila wing imaginal
disc. Development 136: 37473756. Find this article online
4. de la Cova C, Abril M, Bellosta P, Gallant P, Johnston
LA (2004) Drosophila myc regulates organ size by inducing cell competition.
Cell 117: 107116. Find this article online
5. Moreno E, Basler K (2004) dMyc transforms cells
into super-competitors. Cell 117: 117129. Find this article online
6. Baker NE (2008) Cell competition and its possible
relation to cancer. Cancer Res 68: 5050550507. Find this article online
7. Froldi F, Ziosi M, Garoia F, Pession A, Grzeschik
NA, et al. (2010) The lethal giant larvae tumour suppressor mutation requires
dMyc oncoprotein to promote clonal malignancy. BMC
Biol 8: 33. Find this article online
8. Oster SK, Ho CS, Soucie EL, Penn LZ (2002) The myc
oncogene: Marvelous Complex. Adv Cancer Res 84: 81154. Find this article
online
9. Johnston LA, Prober DA, Edgar BA, Eisenman RN, Gallant
P (1999) Drosophila myc regulates cellular growth during development.
Cell 98: 779790. Find this article online
10. Meyer N, Kim SS, Penn LZ (2006) The Oscar-worthy role
of Myc in apoptosis. Semin Cancer Biol 16: 275287. Find this article online
11. Montero L, Müller N, Gallant P (2008) Induction
of Apoptosis by Drosophila Myc. Genesis 46: 104111. Find this article
online
12. Grewal SS, Li L, Orian A, Eisenman RN, Edgar BA (2005)
Myc-dependent regulation of ribosomal RNA synthesis during Drosophila
development. Nat Cell Biol 7: 295302. Find this article online
13. Vita M, Henriksson M (2006) The Myc oncoprotein as a
therapeutic target for human cancer. Semin Cancer Biol 16: 318330. Find
this article online
14. Land H, Parada LF, Weinberg RA (1983) Cellular oncogenes
and multistep carcinogenesis. Science 222: 771778. Find this article online
15. Zhan L, Rosenberg A, Bergami KC, Yu M, Xuan Z, et al.
(2008) Deregulation of Scribble Promotes Mammary Tumorigenesis and Reveals
a Role for Cell Polarity in Carcinoma. Cell 135: 865878. Find this article
online
16. Huang J, Wu S, Barrera J, Matthews K, Pan D (2005) The
Hippo signaling pathway coordinately regulates cell proliferation and apoptosis
by inactivating Yorkie, the Drosophila homolog of YAP. Cell 122:
421434. Find this article online
17. Dong J, Feldmann G, Huang J, Wu S, Zhang N, et al. (2007)
Elucidation of a universal size-control mechanism in Drosophila
and mammals. Cell 130: 11201133. Find this article online
18. Saucedo LJ, Edgar B (2007) Filling out the Hippo pathway.
Nat Rev Mol Cell Biol 8: 613621. Find this article online
19. Tyler DM, Li W, Zhuo N, Pellock B, Baker NE (2006) Genes
affecting cell competition in Drosophila. Genetics 175: 643657.
Find this article online
20. Harvey K, Tapon N (2007) The Salvador-Warts-Hippo pathway
- an emerging tumour-suppressor network. Nat Rev Cancer 3: 182191. Find
this article online
21. Oh H, Irvine KD (2009) In vivo analysis of Yorkie phosphorilation
sites. Oncogene 28: 19161927. Find this article online
22. Ren F, Zhang L, Jiang J (2009) Hippo signaling regulates
Yorkie nuclear localization and activity through 14-3-3 dependent and independent
mechanisms. Dev Biol 337: 303312. Find this article online
23. Nicolay BN, Frolov MV (2008) Context-dependent requirement
for dE2F during oncogenic proliferation. PLoS Genet 4: e1000205. Find this
article online
24. Nolo R, Morrison CM, Tao C, Zhang X, Halder G (2006)
The bantam MicroRNA is a target of the Hippo tumor-suppressor pathway.
Curr Biol 16: 18951904. Find this article online
25. Thompson BJ, Cohen SM (2006) The Hippo pathway regulates
the bantam microRNA to control cell proliferation and apoptosis in Drosophila.
Cell 126: 767774. Find this article online
26. Baena-Lopez LA, Rodriguez I, Baonza A (2008) The tumor
suppressor genes dachsous and fat modulate different signalling pathways
by regulating dally and dally-like. Proc Natl Acad Sci USA 105: 96459650.
Find this article online
27. Goulev Y, Fauny JD, Gonzalez-Marti B, Flagiello D, Silber
J, et al. (2008) SCALLOPED Interacts with YORKIE, the Nuclear Effector
of the Hippo Tumor-Suppressor Pathway in Drosophila. Curr Biol 18:
435441. Find this article online
28. Wu S, Liu Y, Zheng Q, Dong J, Pan D (2008) The TEAD/TEF
family protein Scalopped mediates transcriptional output of the Hippo growth-regulatory
pathway. Dev Cell 14: 388398. Find this article online
29. Zhang L, Ren F, Zhang Q, Chen Y, Wang B, et al. (2008)
The TEAD/TEF family of transcription factor Scalopped mediates Hippo signaling
in organ size control. Dev Cell 14: 377387. Find this article online
30. Zhao B, Ye X, Yu J, Li L, Li W, et al. (2008) TEAD mediates
YAP-dependent gene induction and growth control. Genes Dev 22: 19621971.
Find this article online
31. Peng HW, Slattery M, Mann RS (2009) Transcription factor
choice in the Hippo signaling pathway: homothorax and yorkie regulation
of the microRNA bantam, in the progenitor domain of the Drosophila
eye imaginal disc. Genes Dev 1: 23072319. Find this article online
32. Willecke M, Hamaratoglu F, Kango-Singh M, Udan R, Chen
C, et al. (2006) The Fat Cadherin Acts through the Hippo Tumor-Suppressor
Pathway to Regulate Tissue Size. Curr Biol 16: 111. Find this article
online
33. Silva E, Tsatskis Y, Gardano L, Tapon N, McNeill H (2006)
The Tumor-Suppressor Gene fat Controls Tissue Growth Upstream of Expanded
in the Hippo Signaling Pathway. Curr Biol 16: 20812089. Find this article
online
34. Cho E, Feng Y, Rauskolb C, Maitra S, Fehon R, et al.
(2006) Delineation of a Fat tumor suppressor pathway. Nat Genet 38: 11421150.
Find this article online
35. Bennett FC, Harvey KF (2006) Fat Cadherin Modulates Organ
Size in Drosophila via the Salvador/Warts/Hippo Signaling Pathway.
Curr Biol 16: 21012110. Find this article online
36. Cho E, Irvine KD (2004) Action of fat, four-jointed,
dachsous and dachs in distal-to-proximal wing signaling. Development 131:
44894500. Find this article online
37. Feng Y, Irvine KD (2007) Fat and expanded act in parallel
to regulate growth through warts. Proc Natl Acad Sci USA 104: 2036220367.
Find this article online
38. Willecke M, Hamaratoglu F, Sansores-Garcia L, Tao C,
Halder G (2008) Boundaries of Dachsous Cadherin activity modulate the Hippo
signaling pathway to induce cell proliferation. Proc Natl Acad Sci USA
105: 1489714902. Find this article online
39. Hamaratoglu F, Willecke M, Kango-Singh M, Nolo R, Hyun
E, et al. (2006) The tumour suppressor genes NF2/Merlin and Expanded act
through Hippo signalling to regulate cell proliferation and apoptosis.
Nat Cell Biol 8: 2736. Find this article online
40. Wu S, Huang J, Dong J, Pan D (2003) hippo encodes a Ste-20
family protein kinase that restricts cell proliferation and promotes apoptosis
in conjunction with salvador and warts. Cell 114: 445456. Find this article
online
41. Reddy BVVG, Irvine KD (2008) The Fat and warts signaling
pathways: new insights into their regulation, mechanism and conservation.
Development 135: 28272838. Find this article online
42. Moreno E, Basler K, Morata G (2002) Cells compete for
decapentaplegic survival factor to prevent apoptosis in Drosophila
wing development. Nature 416: 755759. Find this article online
43. Li W, Baker NE (2007) Engulfment is required for cell
competition. Cell 15: 12151225. Find this article online
44. Senoo-Matsuda N, Johnston LA (2007) Soluble factors mediate
competitive and cooperative interactions between cells expressing different
levels of Drosophila Myc. Proc Natl Acad Sci USA 104: 1854318548.
Find this article online
45. Garoia F, Grifoni D, Trotta V, Guerra D, Pezzoli MC,
et al. (2005) The tumor suppressor gene fat modulates the EGFR-mediated
proliferation control in the imaginal tissues of Drosophila melanogaster.
Mech Dev 122: 175187. Find this article online
46. Peter A, Schöttler P, Werner M, Beinert N, Dowe
G, et al. (2002) Mapping and identification of essential gene functions
on the X chromosome of Drosophila. EMBO Rep 31: 3438. Find this
article online
47. Cranna N, Quinn L (2009) Impact of steroid hormone signals
on Drosophila cell cycle during development. Cell Div 20: 4:3. Find
this article online
48. Xiao JH, Davidson I, Matthes H, Garnier JM, Chambon P
(1991) Cloning, expression, and transcriptional properties of the human
enhancer factor TEF-1. Cell 65: 551568. Find this article online
49. Larkin SB, Farrance IK, Ordahl CP (1996) Flanking sequences
modulate the cell specificity of M-CAT elements. Mol Cell Biol 16: 37423755.
Find this article online
50. Bourbon HM, Gonzy-Treboul G, Peronnet F, Alin MF, Ardourel
C, et al. (2002) A P-insertion screen identifying novel X-linked essential
genes in Drosophila. Mech Dev 110: 7183. Find this article online
51. Benassayag C, Montero L, Colombie N, Gallant P, Cribbs
D, et al. (2005) Human c-Myc isoforms differentially regulate cell growth
and apoptosis in Drosophila melanogaster. Mol Cell Biol 25: 98979909.
Find this article online
52. Martín FA, Peréz-Garijo A, Morata G (2009)
Apoptosis in Drosophila: compensatory proliferation and undead cells.
Int J Dev Biol 53: 13411347. Find this article online
53. Oh H, Irvine KD (2008) In vivo regulation of Yorkie phosphorylation
and localization. Development 135: 10811088. Find this article online
54. Lam-Himlin DM, Daniels JA, Gayyed MF, Dong J, Maitra
A, et al. (2006) The hippo pathway in human upper gastrointestinal dysplasia
and carcinoma: a novel oncogenic pathway. Int J Gastrointest Cancer 37:
103109. Find this article online
55. Steinhardt AA, Gayyed MF, Klein AP, Dong J, Maitra A,
et al. (2008) Expression of Yes-associated protein in common solid tumors.
Hum Pathol 39: 15821589. Find this article online
56. Overholtzer M, Zhang J, Smolen GA, Muir B, Li W, et al.
(2006) Transforming properties of YAP, a candidate oncogene on the chromosome
11q22 amplicon. Proc Natl Acad Sci USA 103: 1240512410. Find this article
online
57. Kurant E, Pai CY, Sharf R, Halachmi N, Sun YH, et al.
(1998) Dorsotonals/homothorax, the Drosophila homologue of meis1,
interacts with extradenticle in patterning of the embryonic PNS. Development
125: 10371048. Find this article online
58. Johnston LA, Edgar BA (1998) Wingless and Notch regulate
cell-cycle arrest in the developing Drosophila wing. Nature 394:
8284. Find this article online
59. De la Cova C, Johnston LA (2006) Myc in model organisms:
a view from the fly room. Sem Cancer Biol 16: 303312. Find this article
online
This exciting study by Marcello Ziosi, Luis Baena-López, Daniela Grifoni, Francesca Froldi, Andrea Pession, Flavio Garoia, Vincenzo Trotta, Paola Bellosta, Sandro Cavicchi, and Annalisa Pession reveals the mechanisms for the increased competition and dominance within increased Myc clones in embryonal cells, or of embryomas within adult cells.
1. Each cell retains all of its embryonic genes for a lifetime.
2. Controls for embryonic genes are often absent in adults.
3. Uncontrolled embryonic genes can replicate wildly.
4. Replicating genes participate in intra-cellular competition.
5. The basis for gene competition is selective transcription.
6. MicroRNAs can reprogram embryomic transcription.
7. Gene reprogramming can produce normal phenotypes.
8. Normal phenotypes can by-pass chromosomal lesions.
9. MicroRNA therapy may need to be permanent.
10. Transplantation of microRNAs could be preferred.
1. Pathways within cell genomes involve a flow of information.
2. Information can flow by direct contact or by third parties.
3. Direct contact within whole genomes is difficult to regulate.
4. DNA-DNA direct contects are influenced by agents.
5. Nuclear agents include hydrophilic ionic and hydrophobic conforming ligands.
6. Third parties within genomes involve RNAs and proteins.
7. RNAs and proteins are easy to regulate or reverse.
8. Information can be shared, lost, or transformed.
9. System information can be hidden during system isolation.
10. Local information can be permanently lost during system entropy.
Links to Current
Research in Euchromatin:
Links to
Euchromatin Activator RNA Reviews:
Links to
Euchromatin Activator RNA Research:
Links to Ultrastructural
Probes of DNase I-Sensitive Sites:
Links to
RNA as a Therapeutic Agent:
Links to Hodgkin Lymphoma
Immuno-Pathology:
Links to Activated
T-Lymphocyte Immunotherapy:
Links to Medical
Systems Biology:
Links to Selective
Gene Transcription:
Links to RNA-Induced
Epigenetics:
Links to RNA-Induced
Embryogenesis:
Links to RNA and
Biological Causality:
Links to Reprogramming
and Neoplasia:
A Brief History of Activator RNA:
"Ultrastructural
Probes of Active DNA Sites, and the RNA Activators of DNA".
(PowerPoint Presentation).
Top of Page - Euchromatin
Network - Euchromatin
Research - Research
in Quantitative Radiology
For Further Information and Feedback:
Jeannette A. Hovsepian, M.D.
E-mail: frensasc@ix.netcom.com
Phone: +1 650 367 6483