Suppression of induced pluripotent stem cell generation by the p53-p21 pathway.

Nature 460, 1132-1135 (27 August 2009) |
doi:10.1038/nature08235;
Received 8 September 2008; Accepted 30 June 2009; Published online 9 August 2009
http://www.nature.com/nature/journal/v460/n7259/full/nature08235.html

"Suppression of induced pluripotent stem cell generation by the p53–p21 pathway".

Hyenjong Hong^{1, 2}, Kazutoshi Takahashi¹, Tomoko Ichisaka^{1, 3}, Takashi Aoi¹, Osami Kanagawa⁴, Masato Nakagawa^{1, 2}, Keisuke Okita¹ and Shinya Yamanaka^{1, 2, 3, 5}

¹Center for iPS Cell Research and Application (CiRA), Institute for Integrated Cell-Material Sciences, Kyoto University, Kyoto 606-8507, Japan
²Department of Stem Cell Biology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan
³Yamanaka iPS Cell Special Project, Japan Science and Technology Agency, Kawaguchi 332-0012, Japan
⁴Laboratory for Autoimmune Regulation, RIKEN Center for Allergy and Immunology, RIKEN Yokohama Institute, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan
⁵Gladstone Institute of Cardiovascular Disease, San Francisco, California 94158, USA

Correspondence to: Shinya Yamanaka^{1, 2, 3, 5} Correspondence and requests for materials should be addressed to S.Y. (Email: yamanaka@frontier.kyoto-u.ac.jp).

Abstract:

Induced pluripotent stem (iPS) cells can be generated from somatic cells by the introduction of Oct3/4 (also known as Pou5f1), Sox2, Klf4 and c-Myc, in mouse (1, 2, 3, 4) and in human (5, 6, 7, 8). The efficiency of this process, however, is low (9). Pluripotency can be induced without c-Myc, but with even lower efficiency (10, 11). A p53 (also known as TP53 in humans and Trp53 in mice) short-interfering RNA (siRNA) was recently shown to promote human iPS cell generation (12_, but the specificity and mechanisms remain to be determined. Here we report that up to 10% of transduced mouse embryonic fibroblasts lacking p53 became iPS cells, even without the Myc retrovirus. The p53 deletion also promoted the induction of integration-free mouse iPS cells with plasmid transfection. Furthermore, in the p53-null background, iPS cells were generated from terminally differentiated T lymphocytes. The suppression of p53 also increased the efficiency of human iPS cell generation. DNA microarray analyses identified 34 p53-regulated genes that are common in mouse and human fibroblasts. Functional analyses of these genes demonstrate that the p53–p21 pathway serves as a barrier not only in tumorigenicity, but also in iPS cell generation.

We used the Nanog–GFP (green fluorescent protein) reporter system for sensitive and specific identification of iPS cells3. When the three factors (Oct3/4, Sox2 and Klf4) devoid of c-Myc were introduced into Nanog–GFP, p53 wild-type (p53+/+) mouse embryonic fibroblasts (MEF), we obtained 11 +/- 8 (mean s.d.; n = 4) GFP-positive colonies from 5,000 transduced fibroblasts (Fig. 1a). From Nanog–GFP, p53 heterozygous (p53+/-) mutant MEF, we observed 58 +/- 56 GFP-positive colonies. In contrast, from Nanog–GFP, p53-null (p53-/-) fibroblasts, we obtained significantly more GFP-positive colonies (275 +/- 181) than from wild-type MEF.

Figure 1: iPS cell generation from p53-null MEF by three or four reprogramming factors.

a, iPS cells were generated from Nanog–GFP reporter MEF, which were either p53 wild-type (+/+), heterozygous (+/-), or homozygous (-/-), by the three reprogramming factors (Oct3/4, Sox2 and Klf4). After retroviral transduction, 5,000 live cells were collected by a flow cytometer, and GFP-positive colonies were counted 28 days after transduction. *P < 0.05 compared to wild-type (n = 4).

b, iPS cells were generated by the three factors from single-sorted cells in wells of 96-well plates. GFP-positive colonies were counted 28 days after transduction. **P < 0.01 compared to wild-type (n = 4).

c, iPS cells were generated by the four factors, including c-Myc, from single-sorted cells in wells of 96-well plates. GFP-positive colonies were counted 21 days after transduction. *P < 0.05 compared to wild-type (n = 4).

d, Retroviruses expressing either the dominant-negative p53(Pro275Ser) mutant or wild-type (WT) p53 were co-transduced with the three factors into Nanog–GFP, p53 heterozygous MEF. After retroviral transduction, 5,000 cells were collected and GFP-positive colonies were counted 28 days after the transduction. As a control, retrovirus for a red fluorescent protein (DsRed) was transduced. *P < 0.05 compared to DsRed control (n = 3).

e, Retroviruses expressing either wild-type or mutant p53 were co-transduced with the three factors into Nanog–GFP, p53-null MEF. After retroviral transduction, 5,000 live cells were collected and GFP-positive colonies were counted 28 days after transduction. *P < 0.05 compared to DsRed control (n = 3). Error bars, s.d.

By using a flow cytometer, we plated one Nanog–GFP cell (p53 wild-type, heterozygous mutant, or homozygous mutant), which was transduced with the three factors 5 days before the replating, into a well of a 96-well plate. Twenty-three days after the replating, we observed GFP-positive colonies in few wells per 96-well plate with p53 wild-type or heterozygous fibroblasts (Fig. 1b). In contrast, we observed GFP-positive colonies in 7 +/- 4 (n = 4) wells per 96-well plate with p53-null fibroblasts. These data showed that the loss of p53 function significantly increased the iPS cell induction efficiency, and that up to 10% of transduced cells can become iPS cells even without c-Myc.

We performed the same experiment with the four factors, including c-Myc. We observed GFP-positive colonies in zero or one well per 96-well plate with p53 wild-type fibroblasts (Fig. 1c). In contrast, we observed GFP-positive colonies in 6 +/- 7 and 16 +/- 10 (n = 4) wells per 96-well plate with p53-heterozyous and p53-null fibroblasts, respectively. These data showed that the addition of the Myc retrovirus further increased the efficiency of iPS generation by up to 20%.

We also tested the effect of a dominant-negative p53 mutant Pro275Ser (ref. 13) on iPS cell generation. When Pro275Ser was introduced into Nanog–GFP, p53-heterozygous MEF, we observed a substantial increase in the number of GFP-positive colonies (Fig. 1d). Furthermore, we placed complementary DNAs (cDNAs) encoding the wild-type p53 or transactivation-deficient mutants (Asp278Asn (ref. 14) or Ser58Ala (ref. 15)) into the pMXs retroviral vector (16), and introduced it together with the retroviruses encoding Oct3/4, Sox2 and Klf4 into Nanog–GFP, p53-null MEF. Wild-type p53 significantly decreased the number of GFP-positive colonies (Fig. 1e). The transactivation-deficient p53 mutants, in contrast, did not show significant effects. These data confirmed that the loss of p53 is responsible for the observed increase in the efficiency of direct reprogramming.

We expanded p53-null, GFP-positive clones generated by the three or four factors (six and three clones, respectively). All of the clones showed morphology similar to that of mouse embryonic stem (ES) cells at passage two (Supplementary Fig. 1a). Clones generated by the three factors expressed endogenous Oct3/4, endogenous Sox2, and Nanog at comparable levels to those in ES cells (Supplementary Fig. 1b). The total expression levels of Oct3/4 and Sox2 were also comparable to those in ES cells, indicating that the transgenes were effectively silenced (Supplementary Fig. 1c). When transplanted into nude mice, all six clones gave rise to teratomas containing tissues derived from the three germ layers (Supplementary Fig. 1d). These data confirmed pluripotency of iPS cells generated by the three factors from p53-null MEF.

We found that the expressions of the endogenous Oct3/4 and Sox2 genes were low in p53-null cells generated by the four factors including c-Myc. (Supplementary Fig. 1b). In contrast, the total expression levels of Sox2, Klf4 and c-Myc were markedly higher in these cells than in the remaining iPS and ES cells (Supplementary Fig. 1c), indicating that retroviral expression remained active in these cells. Consistent with this observation, tumours derived from these cells in nude mice largely consisted of undifferentiated cells, with only small areas of differentiated tissues (Supplementary Fig. 1d). Furthermore, the p53-null cells generated by the four factors were not able to maintain an ES-cell-like morphology after passage five (Supplementary Fig. 1e). Thus the c-Myc transgene, in the p53-null background, suppresses retroviral silencing and inhibits the acquirement and maintenance of iPS cell identity.

We next tried to generate iPS cells from terminally differentiated somatic cells by the four factors in a p53-null background (Fig. 2a). We isolated T lymphocytes from Nanog–GFP reporter mice that were either p53 wild-type or p53-null. We activated T cells by anti-CD3 and anti-CD28 antibodies and transduced with the four retroviruses. From p53 wild-type T lymphocytes, we did not obtain any GFP-positive colonies. In contrast, we obtained 11 GFP-positive colonies from p53-null T cells (2 +/- 106 cells), from which three iPS cell lines were established.

Figure 2: T-lymphocyte-derived iPS cells.

a, Protocol for iPS cell generation from mouse T-lymphocytes. d, day; ESM, ES cell medium; TCM, T cell medium.

b, A phase-contrast image, Nanog–GFP expression, alkaline phosphatase (AP) staining, and SSEA1 staining of T-cell-derived iPS cells (clone 408E2) are shown. Scale bars, 100 m.

c, Expression of marker genes was examined by PCR with reverse transcription (RT–PCR) in T-cell-derived iPS cells (clones 408E2/7/8), RF8 ES cells, T cells, spleen, Fbxo15-selected iPS cells from p53 wild-type MEF (clone 7B3), and Nanog-selected iPS cells from p53 wild-type MEF (clone 38D2). Tg, transgene. RT- denotes absence of reverse transcriptase as a control.

d, A chimaera mouse derived from clone 408E2. iPS cells were microinjected into blastocysts from ICR mice.

e, The variable, diversity and joining (V(D)J) DNA rearrangement of the Tcrb gene was confirmed by genomic PCR in iPS cells and a chimaeric mouse. GL, germline band; M denotes lane markers.

These GFP-positive cells were expandable and showed similar morphology to mouse ES cells (Fig. 2b). They were positive for alkaline phosphatase and SSEA1—markers of mouse ES cells (Fig. 2b)—and they expressed ES cell marker genes, including Rex1 (also known as Zfp42) and Nanog (Fig. 2c). In contrast, they did not express T-cell-specific genes such as Fasl, Gzma, Gzmb and Ifng. As was the case in iPS cells derived from p53-null MEF, silencing of the transgenes in these cells was not complete. Nevertheless, we obtained four adult chimaeric mice from these iPS cells (Fig. 2d). As we predicted from the p53-null background and incomplete silencing of the c-Myc retroviruses, three of the four chimaeric mice died within seven weeks. We confirmed the rearrangement of the T-cell receptors in these iPS cells, various tissues from the chimaeras, and the tumour observed in the chimaeras (Fig. 2e). The intensity of the rearranged bands in tumours was as strong as in iPS cells, indicating that the tumour was derived from iPS cells. These data demonstrated that the four factors could generate iPS cells even from terminally differentiated T cells, when p53 is inactivated.

We then examined whether p53 deficiency increased the efficiency of human iPS cell generation. To this end, we introduced the dominant-negative mutant Pro275Ser or a p53 carboxy-terminal dominant-negative fragment (p53DD; ref. 17) into adult human dermal fibroblasts (HDF), together with three or four reprogramming factors. We found that the numbers of iPS cell colonies markedly increased with the two independent p53 dominant-negative mutants (Supplementary Fig. 2a, b). In another experiment, we examined the effects of shRNA against human p53 (shRNA-2)18. We confirmed that the shRNA effectively suppressed the p53 protein levels in HDF (Supplementary Fig. 2c). When co-introduced with the four reprogramming factors, the p53 shRNA markedly increased the number of human iPS cell colonies (Supplementary Fig. 2d). Similar results were obtained in the experiments with three reprogramming factors (Supplementary Fig. 2e). In contrast, suppression of the retinoblastoma protein (RB) did not enhance iPS cell generation. A control shRNA containing one nucleotide deletion in the antisense sequence (shRNA-1) did not show such effects (Supplementary Fig. 2d, e). Co-introduction of the mouse p53 suppressed the effect of the shRNA. When transplanted into the testes of severe combined immunodeficient (SCID) mice, these cells developed teratomas containing various tissues of three germ layers (Supplementary Fig. 2f). These data demonstrated that p53 suppresses iPS cell generation not only in mice, but also in human.

To determine p53 target genes that are responsible for the observed enhancement of iPS cell generation, we compared gene expression between p53 wild-type MEF and p53-null MEF by DNA microarrays, and between control HDF and p53 knockdown HDF. In MEF, 1,590 genes were increased and 1,485 genes were decreased >fivefold in p53-null MEF. In HDF, 290 genes were increased and 430 genes were decreased >fivefold by p53 shRNA. Between mouse and human, there were eight increased genes in common, including v-myb myeloblastosis viral oncogene homologue (MYB) and a RAS oncogene family member, RAB39B (Supplementary Table 1). There were 27 decreased genes in common between the two species, including p53, cyclin-dependent kinase inhibitor 1A (p21, also known as CDKN1A and CIP1), BTG family, member 2 (BTG2), zinc finger, matrin type 3 (ZMAT3), and MDM2.

We transduced four of the increased genes and seven of the decreased genes by retroviruses into HDF, together with either the four reprogramming factors alone or the four factors plus p53 shRNA. Among the four increased genes, none mimicked the effect of p53 suppression (Fig. 3a), whereas among the seven decreased genes, MDM2, which binds to and degrades the p53 proteins, mimicked p53 suppression. Two genes, p53 derived from mouse and p21, effectively counteracted the effect of the p53 shRNA (Fig. 3b). Forced expression of p21 markedly decreased iPS cell generation from p53-null MEF (data not shown). In wild-type MEF, the combination of the four factors markedly increased p21 protein levels (Fig. 3c). When c-Myc was omitted, p21 protein levels still increased, but to a lesser extent than with the four factors together. In p53-null MEF, these increases in p21 protein by either the three or the four factors were not observed. These data highlighted the importance of p21 as a p53 target during iPS cell generation.

Figure 3: p21 as a target of p53 during iPS cell generation.

a, Genes regulated by p53 were introduced into HDF together with the four reprogramming factors. On day 24 after transduction, the numbers of iPS cell colonies were counted. **P < 0.01 compared to DsRed control (n = 3).

b, Genes regulated by p53 were introduced into HDF together with the four reprogramming factors and the p53 shRNA. On day 28 after transduction, the numbers of iPS cell colonies were counted. **P < 0.01 compared to DsRed control (n = 3). All error bars, s.d.

c, Induction of p21 proteins during iPS cell generation. MEF, either wild-type or p53-null, were tranduced with the three or four reprogramming factors. Three days after transduction, p21 and p53 protein levels were determined by western blot analyses.

Moreover, we generated iPS cells from wild-type or p53-null MEF, both containing the Nanog–GFP reporter, by repeated transfection of two expression plasmids, one containing the cDNAs of Oct3/4, Klf4 and Sox2 connected with the 2A polypeptides, and the other one with the c-Myc cDNA19 (Fig. 4a). We plated 1.3 105 MEF and transfected the two plasmids together daily for seven days. Twenty-eight days after the initial transfection, we did not observe any Nanog–GFP-positive colonies from wild-type cells (Fig. 4b). In contrast, 100 GFP-positive colonies emerged from p53-null cells. We randomly picked 12 colonies, and found that seven of them did not contain plasmid integrations (Fig. 4c). By microinjecting these integration-free iPS cells, we obtained adult chimaeric mice (Fig. 4d). It remains to be determined whether germline transmission can be obtained.

Figure 4: Effect of p53 suppression on plasmid-mediated mouse iPS cell generation.

a, Protocol for mouse iPS cell generation by plasmid transfection.

b, Number of GFP-positive colonies. Shown are results of experiment with different transfection reagents.

c, Detection of plasmid integration by genomic PCR. endo, endogenous transcripts only; tg, transgene transcripts only. O-1, O-2, K, K-S, M and 1–8 represent primer sets described in ref. 19.

d, A chimaera mouse derived from integration-free iPS cells. iPS cells were microinjected into blastocysts from ICR mice.

Our data showed that p53 and p21 suppress iPS cell generation. The suppressive effects of these tumour suppressor gene products on cell proliferation, survival or plating efficiency should contribute to the observed effect (Supplementary Fig. 3). In addition, they may have direct effects on reprogramming (20). Permanent suppression of p53 would lower the quality of iPS cells and cause genomic instability. Nevertheless, transient suppression of p53 by siRNA or other methods may be useful in generating integration-free iPS cells for future medical applications (21).

Methods Summary

Effect of p53 suppression in iPS cell generation

Mice deficient in p53 (Taconic Farms, Inc.) were crossed with Nanog–GFP reporter mice3. HDF from facial dermis of a 36-year-old Caucasian female were purchased from Cell Application, Inc. The generation and analyses of mouse iPS cells with retroviruses were performed as previously describe (13, 10, 22). Human iPS cells were generated and evaluated as described (5.) Various p53 mutants were constructed as described in the full Methods. Retroviral vectors for shRNA were purchased from Addgene. The p53 mutants and shRNAs were co-transduced with the reprogramming factors.

Microarray analyses

Total RNAs were analysed with oligonucleotide microarrays (Agilent) and GeneSpring software (Agilent). Microarray data are available from Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) with the accession number GSE13365.

Statistical analyses

Data are shown as average +/- standard deviation. Statistical analyses were performed with one-way repeated-measures analysis of variance (ANOVA) and Bonferroni post-hoc test, using KaleidaGraph 4 (HULINKS).

Full methods accompany this paper.

References

Maherali, N. et al. Directly reprogrammed fibroblasts show global epigenetic remodelling and widespread tissue contribution. Cell Stem Cell 1, 55–70 (2007) | Article | PubMed | ChemPort |

Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872 (2007) | Article | PubMed | ChemPort |

Yu, J. et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917–1920 (2007) | Article | PubMed | ChemPort |

Lowry, W. E. et al. Generation of human induced pluripotent stem cells from dermal fibroblasts. Proc. Natl Acad. Sci. USA 105, 2883–2888 (2008) | Article | PubMed

Park, I. H. et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 141–146 (2008) | Article | PubMed | ChemPort |

Yamanaka, S. Strategies and new developments in the generation of patient-specific pluripotent stem cells. Cell Stem Cell 1, 39–49 (2007) | Article | PubMed | ChemPort |

Nakagawa, M. et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nature Biotechnol. 26, 101–106 (2008) | Article

Wernig, M., Meissner, A., Cassady, J. P. & Jaenisch, R. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell Stem Cell 2, 10–12 (2008) | Article | PubMed | ChemPort |

Zhao, Y. et al. Two supporting factors greatly improve the efficiency of human iPSC generation. Cell Stem Cell 3, 475–479 (2008) | Article | PubMed | ChemPort |

de Vries, A. et al. Targeted point mutations of p53 lead to dominant-negative inhibition of wild-type p53 function. Proc. Natl Acad. Sci. USA 99, 2948–2953 (2002) | Article | PubMed | ChemPort |

Shinmura, K., Bennett, R. A., Tarapore, P. & Fukasawa, K. Direct evidence for the role of centrosomally localized p53 in the regulation of centrosome duplication. Oncogene 26, 2939–2944 (2007) | Article | PubMed | ChemPort |

Cecchinelli, B. et al. Ser58 of mouse p53 is the homologue of human Ser46 and is phosphorylated by HIPK2 in apoptosis. Cell Death Differ. 13, 1994–1997 (2006) | Article | PubMed | ChemPort |

Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T. & Yamanaka, S. Generation of mouse induced pluripotent stem cells without viral vectors. Science 322, 949–953 (2008) | Article | PubMed | ChemPort |

Yamanaka, S. Elite and stochastic models for induced pluripotent stem cell generation. Nature 460, 49–52 (2009) | Article | PubMed | ChemPort |

Yamanaka, S. A fresh look at iPS cells. Cell 137, 13–17 (2009) | Article | PubMed | ChemPort |

Aoi, T. et al. Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 321, 699–702 (2008) | Article | PubMed | ChemPort |

Additional References:

1. . Krizhanovsky V, and Lowe SW,
"The promises and perils of p53".

2. Marión RM, Strati K, Li H, Murga M, Blanco R, Ortega S, Fernandez-Capetillo O, Serrano M, Blasco MA.
"A p53-mediated DNA damage response limits reprogramming to ensure iPS cell genomic integrity".

3. Utikal J, Polo JM, Stadtfeld M, Maherali N, Kulalert W, Walsh RM, Khalil A, Rheinwald JG, and Hochedlinger K.
"Immortalization eliminates a roadblock during cellular reprogramming into iPS cells".

Supplementary Information
http://www.nature.com/nature/journal/v460/n7259/suppinfo/nature08235.html

Acknowledgements

We thank D. Srivastava for critical reading of the manuscript; M. Narita, A. Okada, N. Takizawa, H. Miyachi and S. Kitano for technical assistance; and R. Kato, S. Takeshima, Y. Ohtsu and E. Nishikawa for administrative assistance. We also thank Y. Sasai and T. Tada for technical advices, T. Kitamura for Plat-E cells and pMXs retroviral vectors, R. Farese for RF8 ES cells, and B. Weinberg and W. Hahn for shRNA constructs. This study was supported in part by a grant from the Leading Project of MEXT, Grants-in-Aid for Scientific Research of JSPS and MEXT, and a grant from the Program for Promotion of Fundamental Studies in Health Sciences of NIBIO (to S.Y.). H. H. is a research student under the Japanese Government (MEXT).

Author Contributions

H.H. conducted most of the experiments in this study. K.T. generated iPS cells from T cells and also performed the shRNA experiments. T.I. performed manipulation of mouse embryos, teratoma experiments, and mouse line maintenance. T.A. and O.K. optimized retroviral transduction into T cells. M.N. generated iPS cells with plasmids. K.O. generated the Nanog–GFP reporter mice and the plasmids for iPS cell generation. K.O. and K.T. supervised H.H. S.Y. designed and supervised the study, and prepared the manuscript.

Microarray data are available at the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) public database under accession number GSE13365.

Online Methods

Generation of p53 retroviral vectors

cDNA of mouse p53 gene was amplified by RT–PCR with p53-1S (CACCAGGATGACTGCCATGGAGGAGTC) and p53-1223AS (GTGTCTCAGCCCTGAAGTCATAA), and subcloned into pENTR-D-TOPO (Invitrogen). After sequencing verification, cDNA was transferred to pMXs-gw by Gateway cloning technology (Invitrogen). Retroviral vectors for p53 mutants were generated by two-step PCR. For the Pro275Ser mutant, the first PCR was performed with two primer sets, p53-Pro275Ser-S (TGTTTGTGCCTGCTCTGGGAGAGACCGC) and p53-1223AS, and p53-Pro275Ser-AS (GCGGTCTCTCCCAGAGCAGGCACAAACA) and p53-1S. For the DD mutant, the first PCR was performed with two primer sets, p53-DD-S (CGGATATCAGCCTCAAGAGAGCGCTGCC) and p53-1223AS, and p53-DD-AS (GGCAGCGCTCTCTTGAGGCTGATATCCG) and p53-1S. For the Asp278Asn mutant, the first PCR was performed with two primer sets, p53-Asp278Asn-S (TGCCCTGGGAGAAACCGCCGTACAGAA) and p53-1223AS, and p53-Asp278Asn-AS (TTCTGTACGGCGGTTTCTCCCAGGGCA) and p53-1S. For the Ser58Ala mutant, the first PCR was performed with two primer sets, p53-Ser58Ala-S (TTTGAAGGCCCAGCTGAAGCCCTCCGA) and p53-1223AS, and p53-S58A-AS (TCGGAGGGCTTCAGCTGGGCCTTCAAA) and p53-1S. The two PCR products of each first PCR were mixed and used as a template for the secondary PCR with the primer set p53-1S and p53-1223AS. These mutants were cloned into pENTR-D-TOPO, and then transferred to pMXs-gw by Gateway cloning technology.

Effect of p53 suppression in iPS cell generation from MEF

Wild type, p53+/- or p53-/- MEF, which also contain the Nanog–GFP reporter, were seeded at 1 105 cells per well of 6-well plates. Retroviral transduction was performed the next day (day 0) with retrovirus made from Plat-E16. On day 5, cells were reseeded either at one cell per well of a 96-well plate using a cell sorter ( FACS Aria, Beckton Dickinson) or 5,000 cells per 100-mm dish. Puromycin selection (1.5 g ml-1) was initiated on day 13 in the four-factor protocol, and on day 19 in the three-factor protocol. The numbers of GFP-positive colonies were determined on day 21 for the four-factor protocol, and on day 28 in the three-factor protocol. In addition to the targeted disruption, p53 was suppressed in MEF by a dominant-negative mutant, Pro275Ser.

Effect of p53 suppression in iPS cell generation from HDF

Function of p53 was suppressed in HDF either by the dominant-negative mutants (Pro275Ser or DD) or by shRNAs (pMKO.1-puro, pMKO.1-puro p53 shRNA-1, or pMKO.1-puro p53 shRNA-2 from Addgene). Retrovirus for the dominant-negative mutants, shRNAs, and the four reprogramming factors were produced in Plat-E cells. For iPS cell generation, we plated 2 105 cells per well of a 6-well plate 1 day before transduction. The next day, HDF were transduced overnight with equal amounts of Plat-E supernatants containing each retrovirus, supplemented with 4 g ml-1 polybrene.

In assays with dominant-negative mutants, 6 days after infection, transduced HDF were collected and replated at 5 103 (with the four reprogramming factors) or 4 104 (with the three factors) per 100-mm dish on mitomycin-C-treated SNL feeder cells. The next day, the medium was replaced with Primate ES cell medium (ReproCELL) supplemented with 4 ng ml-1 bFGF. The medium was changed every other day. We counted the number of iPS cell colonies at day 30 after transduction (with the four factors) or day 40 (with the three factors).

In the experiments with shRNA-mediated knockdown, 6 days after infection, the transduced cells were replated at 5 x 10⁴ cells per 100-mm dish onto mitomycin-C-treated SNL feeder. The next day, we started cultivation of the cells with the human ES cell culture condition. Twenty-four days after transduction, we counted the number of iPS colonies, isolated them, and used them for functional analyses.

Generation of iPS cells from T cells

Spleen from p53-null, Nanog–GFP male mouse was dissected, minced and suspended in T cell medium consisting of DMEM containing 10% heat-inactivated fetal bovine serum (FBS; Thermo). T lymphocytes were isolated using mouse CD90 microbeads (Miltenyi biotec) and plated at 1 106 cells per well of RetroNectin (50 g ml-1; Takara)-coated 24-well plates in T cell medium supplemented with Dynabeads CD3/CD28 T cell Expander (10 l for 1 106 cells; Invitrogen) and 10 units ml-1 of IL-2.

Retroviruses were prepared as described previously 1, 3, 5. We added 8 g ml-1 of polybrene (Nacalai tesque) and 10 units ml-1 of IL-2 to virus-containing supernatant. The four reprogramming factors or DsRed were introduced by retroviral transduction with centrifugation (1,580g for 30 min), and then incubated in a 37 °C, 5% CO2 incubator. Twenty-four hours after transduction, the medium was replaced, and then half of the medium was changed every other day. Two weeks after transduction, the cells were plated at 5 x 10⁴ cells per 100-mm dish onto mitomycin-C-treated puromycin-resistant SNL feeder in ES medium, which consisted of DMEM (Nacalai tesque) supplemented with 15% FBS, 2 mM l-glutamine (Invitrogen), 1 x 10^-4 M non-essential amino acids (Invitrogen), 1 x 10^-4 M 2-mercaptoethanol (Invitrogen) and 0.5% penicillin and streptomycin (Invitrogen). The next day, selection was started with 1.5 g ml-1 puromycin for 5 days.

V(D)J DNA rearrangements of the Tcrb gene were confirmed by PCR with primers D2
(GTAGGCACCTGTGGGGAAGAAACT) and J2 (TGAGAGCTGTCTCCTACTATCGATT)23. PCR products were separated on a 1.2% agarose gel.

Functional analyses of p53 target genes

Open reading frames of p53 target genes were amplified by PCR and subcloned into pENTR-D-TOPO. Some target genes were obtained from National Institute of Technology and Evaluation (NITE, Japan). These cDNAs were transferred to pMXs-gw using the gateway cloning system. We transduced retroviruses of each of the p53 target genes along with the reprogramming factors, either with or without the p53-knockdown construct. Six days after infection, cells were collected and replated at 5 104 cells per 100-mm dish on mitomycin-C-treated SNL feeder cells. The next day, we started cultivation of the cells with human ES cell culture condition. We counted the number of iPS cell colonies at day 24 (with the four factors) or 28 (with the three factors) after transduction.

Generation of integration-free mouse iPS cells from p53-null MEF by plasmid transfection

Generation of integration-free mouse iPS cells was performed as previously described19, with some modifications. In brief, wild type or p53-/- Nanog–GFP MEF were seeded at 1.3 105 cells per well of gelatin-coated 6-well plates (day 0). Co-transfection of pCX-OKS-2A and pCX-cMyc using FuGENE6 (Roche) or Lipofectamine LTX (plus reagent) (Invitrogen) was done once a day from days 1 to 7. The cells were cultivated with ES medium containing LIF from day 4. From day 21, puromycin (1.5 g ml-1) was added to the medium. On day 34, several GFP-positive colonies were picked up for expansion.
Integration of plasmids into host chromosomes was examined with genomic PCR19.

FIGURE 1. iPS cell generation from p53-null MEF by three or four reprogramming factors.

FIGURE 2. T-lymphocyte-derived iPS cells.

FIGURE 2. T-lymphocyte-derived iPS cells.

a, Protocol for iPS cell generation from mouse T-lymphocytes. d, day; ESM, ES cell medium; TCM, T cell medium.

b, A phase-contrast image, Nanog–GFP expression, alkaline phosphatase (AP) staining, and SSEA1 staining of T-cell-derived iPS cells (clone 408E2) are shown. Scale bars, 100 m.

d, A chimaera mouse derived from clone 408E2. iPS cells were microinjected into blastocysts from ICR mice.

e, The variable, diversity and joining (V(D)J) DNA rearrangement of the Tcrb gene was confirmed by genomic PCR in iPS cells and a chimaeric mouse. GL, germline band; M denotes lane markers.

FIGURE 3. p21 as a target of p53 during iPS cell generation.

FIGURE 4. Effect of p53 suppression on plasmid-mediated mouse iPS cell generation.

a, Protocol for mouse iPS cell generation by plasmid transfection.

b, Number of GFP-positive colonies. Shown are results of experiment with different transfection reagents.

c, Detection of plasmid integration by genomic PCR. endo, endogenous transcripts only; tg, transgene transcripts only. O-1, O-2, K, K-S, M and 1–8 represent primer sets described in ref. 19.

d, A chimaera mouse derived from integration-free iPS cells. iPS cells were microinjected into blastocysts from ICR mice.

Additional references:

1. 36c. Frenster JH, and Hovsepian JA, (October, 2007c)
“Models of Embryonic Gene-Induced Initiation and Reversion of Adult Neoplasms”.

2. Berx G, Raspe E, Christfori G, Thiery JP, and Sleeman JP, (November, 2007)
"Pre-EMTing metastasis? Recapitulation of morphogenetic processes in cancer".
Clin Exp Metastasis, 2007;24(8):587-97, Epub 2007 Nov3.

3. Sarrió D, Rodriguez-Pinilla SM, Hardisson D, Cano A, Moreno-Bueno G, and Palacios J, (Feb. 2008)
"Epithelial-Mesenchymal Transition in Breast Cancer Relates to the Basal-like Phenotype",
Cancer Research 68, 989-997, February 15, 2008.

4. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, and Jacks T., (March, 2008)
"Suppression of non-small cell lung tumor development by the let-7 microRNA family".

5. Haigis KM, Kendall KR, Wang Y, Cheung A, Haigis MC, Glickman JN, Niwa-Kawakita M, Sweet-Cordero A, Sebolt-Leopold J, Shannon KM, Settleman J, Giovannini M, and Jacks T. (March 30, 2008)
"Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation and tumor progression in the colon".
Nature Genetics 40, 600 - 608 (2008). Published online: 30 March 2008 | doi:10.1038/ng.115)

6. Boyerinas B, Park S-M, Shomron N, Hedegaard MM, Vinther J, Andersen JS, Feig C, Xu J, Burge CB, and Peter ME, (April, 15, 2008)
"Identification of Let-7–Regulated Oncofetal Genes",
Cancer Research vol. 68, no. 8, pp. 2587-2591 (April 15, 2008).

7. Marcucci G, Radmacher MD, Maharry K, Mrózek K, Ruppert AS, Paschka P, Vukosavljevic T, Whitman SP, Baldus CD, Langer C, Liu C-G, Carroll AJ, Powell BL, Garzon R, Croce CM, Kolitz JE, Caligiuri MA, Larson RA, and Bloomfield CD, (May 1, 2008)
"MicroRNA Expression in Cytogenetically Normal Acute Myeloid Leukemia",
New England Journal of Medicine vol. 358: no. 18, pp. 1919-1928 May 1, 2008.)

8. Mani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J, and Weinberg RA, (May 16, 2008)
"The Epithelial-Mesenchymal Transition Generates Cells with Properties of Stem Cells".
Cell, vol: 133, pp. 704-715 (May 16, 2008).

Further Topics in: Euchromatin, active DNA, and RNA ribo-regulators:

Links to Current Research in Euchromatin:
Links to Euchromatin Activator RNA Reviews:
Links to Euchromatin Activator RNA Research:
Links to Ultrastructural Probes of DNase I-Sensitive Sites:
Links to RNA as a Therapeutic Agent:
Links to Hodgkin Lymphoma Immuno-Pathology:
Links to Activated T-Lymphocyte Immunotherapy:
Links to Medical Systems Biology:
Links to Selective Gene Transcription:
Links to RNA-Induced Epigenetics:
Links to RNA-Induced Embryogenesis:
Links to RNA and Biological Causality:
Links to Reprogramming and Neoplasia:

A Brief History of Activator RNA:

"Ultrastructural Probes of Active DNA Sites, and the RNA Activators of DNA".
(PowerPoint Presentation).

Top of Page - Euchromatin Network - Euchromatin Research - Research in Quantitative Radiology

For Further Information and Feedback:

Jeannette A. Hovsepian, M.D.
E-mail: frensasc@ix.netcom.com
Phone: +1 650 367 6483

euchromatin: "the most active portion of the genome within the cell nucleus".
embryoma: "adult neoplasm expressing one or more embryo-exclusive genes".